Home | Projects | Login or register:
Username:   Password:

Worm gene name:  sel-12
Worm sequence name:  F35H12.3
Related human gene:  presenelin (PS1)
Associated human disease:  Picks Disease/ Alzheimers
People involved in this project: 
Left primer sequence:  atgctctcgtcatgttgtgc
Right primer sequence:  atggtccttttggtgtgagc
Size of PCR product:  444
Brief description:  transmembrane protein orthologous to presenilins, regulation of notch-like signaling pathways
Report any problems that might have appeared and any solutions: 
View(0) or add comments