Worm gene name: | sel-12 |
Worm sequence name: | F35H12.3 |
Related human gene: | presenelin (PS1) |
Associated human disease: | Picks Disease/ Alzheimers |
People involved in this project: |
|
Left primer sequence: | atgctctcgtcatgttgtgc |
Right primer sequence: | atggtccttttggtgtgagc |
Size of PCR product: | 444 |
Brief description: | transmembrane protein orthologous to presenilins, regulation of notch-like signaling pathways |
Report any problems that might have appeared and any solutions: | |