| Worm gene name: | sel-12 |
| Worm sequence name: | F35H12.3 |
| Related human gene: | presenelin (PS1) |
| Associated human disease: | Picks Disease/ Alzheimers |
| People involved in this project: |
|
| Left primer sequence: | atgctctcgtcatgttgtgc |
| Right primer sequence: | atggtccttttggtgtgagc |
| Size of PCR product: | 444 |
| Brief description: | transmembrane protein orthologous to presenilins, regulation of notch-like signaling pathways |
| Report any problems that might have appeared and any solutions: | |
