Home | Projects | Login or register:
Username:   Password:

Worm gene name:  dpy-28
Worm sequence name:  Y39A1B.3
Related human gene:  CNAP1
Associated human disease:  not known
People involved in this project: 
  • Ray Hong, California State University, Northridge, CA
Left primer sequence:  ggaaatgaaaaagcatcgga
Right primer sequence:  tccacaacgaatcatcctga
Size of PCR product:  572
Brief description:  This protein is involved in negative chromosome-wide regulation of X chromosome gene expression and is known to cause abnormalities in embryogenesis and locomotion by RNAi and mutations.
Report any problems that might have appeared and any solutions: 
View(0) or add comments