| Worm gene name: | dpy-28 |
| Worm sequence name: | Y39A1B.3 |
| Related human gene: | CNAP1 |
| Associated human disease: | not known |
| People involved in this project: |
|
| Left primer sequence: | ggaaatgaaaaagcatcgga |
| Right primer sequence: | tccacaacgaatcatcctga |
| Size of PCR product: | 572 |
| Brief description: | This protein is involved in negative chromosome-wide regulation of X chromosome gene expression and is known to cause abnormalities in embryogenesis and locomotion by RNAi and mutations. |
| Report any problems that might have appeared and any solutions: | |
