Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Let-29
Worm sequence name:  Y71H2AM.20a.
Related human gene:  Protein Phosphatase 2A
Associated human disease: 
People involved in this project: 
Left primer sequence:  tcgacatgctggataagctg
Right primer sequence:  aataagctgagcgcttccaa
Size of PCR product:  566
Brief description:  PP2A is a ubiquitious protein phosphatase involved in a number of cellular processes. We are interested in its interaction with the cyanobacterial hepatotoxin microcystin.
Report any problems that might have appeared and any solutions:  None so far
View(0) or add comments