| Worm gene name: | Let-29 |
| Worm sequence name: | Y71H2AM.20a. |
| Related human gene: | Protein Phosphatase 2A |
| Associated human disease: | |
| People involved in this project: |
|
| Left primer sequence: | tcgacatgctggataagctg |
| Right primer sequence: | aataagctgagcgcttccaa |
| Size of PCR product: | 566 |
| Brief description: | PP2A is a ubiquitious protein phosphatase involved in a number of cellular processes. We are interested in its interaction with the cyanobacterial hepatotoxin microcystin. |
| Report any problems that might have appeared and any solutions: | None so far |
