Home | Projects | Login or register:
Username:   Password:

Worm gene name:  SRC-1
Worm sequence name:  Y92H12A.1
Related human gene:  Her2/neu aka ERBB2
Associated human disease:  higher aggressiveness in breast cancer
People involved in this project: 
Left primer sequence:  gatcccgcaatttttgaaga
Right primer sequence:  tcgtgaagtcgtcgaacaag
Size of PCR product:  20
Brief description:  HER2/neu aka ERBB2, Human Epidermal Growth Factor receptor 2, is a protein that gives higher aggressiveness in breast cancer. Y92H12A.1 is the C. elegans homolog.
Report any problems that might have appeared and any solutions: 
View(0) or add comments