| Worm gene name: | SRC-1 |
| Worm sequence name: | Y92H12A.1 |
| Related human gene: | Her2/neu aka ERBB2 |
| Associated human disease: | higher aggressiveness in breast cancer |
| People involved in this project: |
|
| Left primer sequence: | gatcccgcaatttttgaaga |
| Right primer sequence: | tcgtgaagtcgtcgaacaag |
| Size of PCR product: | 20 |
| Brief description: | HER2/neu aka ERBB2, Human Epidermal Growth Factor receptor 2, is a protein that gives higher aggressiveness in breast cancer. Y92H12A.1 is the C. elegans homolog. |
| Report any problems that might have appeared and any solutions: | |
