Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Lam1
Worm sequence name:  DY3.2
Related human gene:  lamin gene
Associated human disease:  one gene thought to be involved with Hutchinson-Gilford progeria
People involved in this project: 
Left primer sequence:  gatcgagtatgacgctgcaa
Right primer sequence:  agcacgcatctcttcgattt
Size of PCR product:  494
Brief description:  Lam 1 encodes nuclear lamin in C. elegans. This protein is required for nuclear envelope localization during early development since the protein binds mitotic chromosomes and certain histones.
Report any problems that might have appeared and any solutions: 
View(0) or add comments