| Worm gene name: | Lam1 |
| Worm sequence name: | DY3.2 |
| Related human gene: | lamin gene |
| Associated human disease: | one gene thought to be involved with Hutchinson-Gilford progeria |
| People involved in this project: |
|
| Left primer sequence: | gatcgagtatgacgctgcaa |
| Right primer sequence: | agcacgcatctcttcgattt |
| Size of PCR product: | 494 |
| Brief description: | Lam 1 encodes nuclear lamin in C. elegans. This protein is required for nuclear envelope localization during early development since the protein binds mitotic chromosomes and certain histones. |
| Report any problems that might have appeared and any solutions: | |
