Home | Projects | Login or register:
Username:   Password:

Worm gene name:  let-60
Worm sequence name:  ZK792.6
Related human gene:  Ras
Associated human disease:  Sarcomas
People involved in this project: 
Left primer sequence:  atgcctcctcgacatattgg
Right primer sequence:  cagaccgggtgtcgtatttt
Size of PCR product:  542
Brief description:  Ras is a family of proteins involved in cell signaling pathways that modulate cell growth and proliferation. Mutations in the Ras family(H-Ras, N-Ras, K-Ras)of protooncogenes are being implicated in 20-30% of human tumors.
Report any problems that might have appeared and any solutions: 
View(0) or add comments