| Worm gene name: | let-60 |
| Worm sequence name: | ZK792.6 |
| Related human gene: | Ras |
| Associated human disease: | Sarcomas |
| People involved in this project: |
|
| Left primer sequence: | atgcctcctcgacatattgg |
| Right primer sequence: | cagaccgggtgtcgtatttt |
| Size of PCR product: | 542 |
| Brief description: | Ras is a family of proteins involved in cell signaling pathways that modulate cell growth and proliferation. Mutations in the Ras family(H-Ras, N-Ras, K-Ras)of protooncogenes are being implicated in 20-30% of human tumors. |
| Report any problems that might have appeared and any solutions: | |
