Worm gene name: | K02D7.1 |
Worm sequence name: | K02D7.1 |
Related human gene: | NP |
Associated human disease: | Deficiency of nucleoside phosphorylase results in defective T-cell immunity |
People involved in this project: |
|
Left primer sequence: | cgcctcaatcagagagcaag |
Right primer sequence: | tccaccggacatcacataga |
Size of PCR product: | 744 |
Brief description: | Nil |
Report any problems that might have appeared and any solutions: | Nil |