| Worm gene name: | K02D7.1 |
| Worm sequence name: | K02D7.1 |
| Related human gene: | NP |
| Associated human disease: | Deficiency of nucleoside phosphorylase results in defective T-cell immunity |
| People involved in this project: |
|
| Left primer sequence: | cgcctcaatcagagagcaag |
| Right primer sequence: | tccaccggacatcacataga |
| Size of PCR product: | 744 |
| Brief description: | Nil |
| Report any problems that might have appeared and any solutions: | Nil |
