Worm gene name: | olrn-1 |
Worm sequence name: | C02C6.2a |
Related human gene: | na |
Associated human disease: | na |
People involved in this project: |
|
Left primer sequence: | cgagtgcagaaaactgtcca |
Right primer sequence: | caaagcatcgggaatcgtat |
Size of PCR product: | 592 |
Brief description: | Homolog of a Drosophila gene. |
Report any problems that might have appeared and any solutions: | |