Home | Projects | Login or register:
Username:   Password:

Worm gene name:  olrn-1
Worm sequence name:  C02C6.2a
Related human gene:  na
Associated human disease:  na
People involved in this project: 
Left primer sequence:  cgagtgcagaaaactgtcca
Right primer sequence:  caaagcatcgggaatcgtat
Size of PCR product:  592
Brief description:  Homolog of a Drosophila gene.
Report any problems that might have appeared and any solutions: 
View(0) or add comments