Worm gene name: | hum-6 |
Worm sequence name: | T10H10.1 |
Related human gene: | MYO7A and MYO15A |
Associated human disease: | Hereditary Deafness |
People involved in this project: |
|
Left primer sequence: | cagggaccagtgaacaggat |
Right primer sequence: | ttgtctcgaacgcaaaacag |
Size of PCR product: | 339 |
Brief description: | hum-6 is orthologous to the human gene MYOSIN VIIA (MYO7A; OMIM:276903), which when mutated leads to Usher syndrome type IB.
hum-6 is also homologous to human MYO15, which when mutated leads to autosomal recessive neurosensory deafness 3 (OMIM:600316) |
Report any problems that might have appeared and any solutions: | |