Home | Projects | Login or register:
Username:   Password:

Worm gene name:  hum-6
Worm sequence name:  T10H10.1
Related human gene:  MYO7A and MYO15A
Associated human disease:  Hereditary Deafness
People involved in this project: 
Left primer sequence:  cagggaccagtgaacaggat
Right primer sequence:  ttgtctcgaacgcaaaacag
Size of PCR product:  339
Brief description:  hum-6 is orthologous to the human gene MYOSIN VIIA (MYO7A; OMIM:276903), which when mutated leads to Usher syndrome type IB.
hum-6 is also homologous to human MYO15, which when mutated leads to autosomal recessive neurosensory deafness 3 (OMIM:600316)
Report any problems that might have appeared and any solutions: 
View(0) or add comments