Home | Projects | Login or register:
Username:   Password:

Worm gene name:  PAH-1
Worm sequence name:  K08F8.4
Related human gene:  phenylalanine hydroxylase
Associated human disease:  phenylketonuria
People involved in this project: 
Left primer sequence:  ccgctccaaaatacacacct
Right primer sequence:  gatggtagctgcccatgatt
Size of PCR product:  401
Brief description:  Phenylketonuria (PKU) is an autosomal recessive inborn error of metabolism resulting from a deficiency of phenylalanine hydroxylase (EC 1.14.16.1), an enzyme that catalyzes the hydroxylation of phenylalanine to tyrosine, the rate-limiting step in phenylalanine catabolism. The reaction is dependent on tetrahydrobiopterin (BH4), as a cofactor, molecular oxygen, and iron. If undiagnosed and untreated, phenylketonuria can result in impaired postnatal cognitive development resulting from a neurotoxic effect of hyperphenylalaninemia. (from OMIM)
Report any problems that might have appeared and any solutions: 
View(1) or add comments