| Worm gene name: | F29B9.4 |
| Worm sequence name: | Fos |
| Related human gene: | c-fos |
| Associated human disease: | Fos is a human oncogene and a component of the AP-1 transcription factor complex. |
| People involved in this project: |
|
| Left primer sequence: | atgtcggcaaaggagaattg |
| Right primer sequence: | cgaaaccgggatagaagtga |
| Size of PCR product: | 487 |
| Brief description: | The AP-1 transcription factor is composed of members of the Fos and Jun DNA binding proteins families. AP-1 is involved in response to several environmental stresses, including inflammation and heat shock. An active AP-1 response element appears in the human serine racemase gene. Serine racemase (S-Race) is a pyridoxal-phosphate dependent enzyme that synthesizes D-serine and pyruvate from L-serine. D-serine, binding at a site traditionally known as the ‘glycine site’, is a coagonist of the NMDA class of glutamate neurotransmitter receptor.
The C. elegans ortholog of the human serine racemase gene contains a canonical AP-1 element. I would like to determine if the AP-1 element in C. elegans is functional. A heat shock model for C. elegans has been developed. AP-1 is downregulated in the heat response, and heat response has been shown to interfere with learning in C. elegans, providing a phenotype for scoring. If the AP-1 site is active in regulating the C. elegans serine racemase gene, the inhibition of Fos (AP-1) expression should result in upregulation or downregulation of the serine racemase gene, depending on whether AP-1 serves as an enhancer or inhibitor of the gene. This data may provide a link between serine racemase expression and the dementia observed in AD disease. |
| Report any problems that might have appeared and any solutions: | |
I tried to using the primers to produce an amplicon in L440. PCR at 50 and 55 did not yield any product.