| Worm gene name: | dys-1 |
| Worm sequence name: | F15D3.1a |
| Related human gene: | DMD |
| Associated human disease: | Duchenne muscular dystrophy |
| People involved in this project: |
|
| Left primer sequence: | aaaatcatcgtcatcctcgc |
| Right primer sequence: | ttcacaagatgcaagttcgc |
| Size of PCR product: | 324 |
| Brief description: | Duchenne Muscular Dystrophy is an X-linked disorder that causes progressive muscle degeneration. Onset of symptoms occurs between 2-5 years of age and death by 20 years of age from respiratory or cardiac failure. The DMD gene is enormous, spanning 2500 kb and with 74 exons, and encoding the dystrophin protein. The function of dystrophin appears to be to connect the sarcolemmal cytoskeleton to the extra-cellular matrix. The ortholog of the human DMD gene in C. elegans is dys-1. This gene is expressed in the muscles of the body wall, head, vulva, and pharynx. Phenotypic expression is embryonic and postembryonic lethal, female sterility and aldicarb (and insecticide) resistant. |
| Report any problems that might have appeared and any solutions: | |
