| Worm gene name: | apr-1 |
| Worm sequence name: | K04G2.8 |
| Related human gene: | APC |
| Associated human disease: | Familial adenomatous polyposis |
| People involved in this project: |
|
| Left primer sequence: | tcttcctgcgtcaaactgtg |
| Right primer sequence: | cagcaagattccacaaagca |
| Size of PCR product: | 539 |
| Brief description: | Source: OMIM. "The APC gene encodes a multidomain protein that plays a major role in tumor suppression by antagonizing the WNT signaling pathway. Inappropriate activation of this pathway through loss of APC function contributes to cancer progression, as in familial adenomatous polyposis. APC also has a role in cell migration, adhesion, chromosome segregation, spindle assembly, apoptosis, and neuronal differentiation." |
| Report any problems that might have appeared and any solutions: | Status 8/7: Primers didn't work with 60 degree annealing step, so tried again at 55 and got a faint band. Amplicon has been cloned into T-tailed pGEM vector. Needs to be subcloned into the RNAi expression vector. |
Three of us at the Austin, TX workshop cloned the amplicon into L4440 and pGEMT. Colony PCR did not work. PCR on mini plasmid preps showed the right sized band for L4440. NotI digest of pGEMT showed a fragment that was approximately 300 bp.