Worm gene name:  ttx-1
Worm sequence name:  Y113G7A.6
Related human gene:  Otx2
Associated human disease:  Microphthalmia
People involved in this project: 
  • James Smith, Montgomery College - Takoma Park/Silver Spring Campus, MD
Left primer sequence:  agcccatattcgacgacaac
Right primer sequence:  tctcggggagttgaattttg
Size of PCR product:  418
Brief description:  In progress.
Report any problems that might have appeared and any solutions: