| Worm gene name: | mec-5 |
| Worm sequence name: | E03G2.3 |
| Related human gene: | alpha 2 type V collagen preproprotein |
| Associated human disease: | Ehlers Danlos Syndrome |
| People involved in this project: |
|
| Left primer sequence: | aaaggagatatgggaccgct |
| Right primer sequence: | actcctgggactcctccatt |
| Size of PCR product: | 375 |
| Brief description: | In humans, Ehlers-Danlos (E.D.) syndrome is a disorder attributed to mutations collagen V. Most persons with the Ehlers-Danlos syndrome are born premature because fetal membranes rupture prematurely. Adults with E.D. syndrome show many abnormal conditions including looseness of joints, easily bruised skin, rupturing of large blood vessels and bowels, and retinal detachment. Those with E.D. syndrome also suffer lacerations and blistering from minor trauma. A gene associated with Ehlers-Danlos, type I (severe) and II (moderate) is found on chromosome 2q32 and produces the transcript for alpha-2 type V collagen preprotein (NP_00384).
A BLAST search, using NP_00384 as a bait for the translated C. elegans genome retrieved many hits, 20 of which scored 1e-11 or better. From these, we chose two separate C. elegans genes for further study by RNAi. The first, located on chromosome III of C. elegans, is dpy-17, sequence F54D8.1, WBGene00001076. dpy-17 encodes a cuticle collagen and is required for normal body shape, hermaphrodite tail development, and outgrowth of posterior canal processes. Previous RNAi experiments targeting dpy-17 have produced the dumpy phenotype and protruding vulva. The second gene chosen was mec-5, sequence E03G2.3, WBGene00003169, located on chromosome X. This gene encodes a member of the gene class MEChanosensory Abnormality. A unique extracellular collagen is produced by mec-5, and is thought to be important for functional orientation of touch receptors and their associated ion channels. In C. elegans, mutations of mec-5 cause worms to be lethargic, and insensitive to touch. Previous large scale RNAi experiments targeting mec-5 have been conducted, although no obvious phenotypes were reported. We have used E-RNAi to design primers that target dpy-17 and mec-5. We hypothesize that RNAi targeting of dpy-17 will result in worms with the dumpy phenotype, while RNAi targeting of mec-5 will results in worms that are lethargic and insensitive to touch. We await results obtained by upcoming workshop participants to test these hypotheses. |
| Report any problems that might have appeared and any solutions: | |
