| Worm gene name: | vha-6 |
| Worm sequence name: | VW02B12L.1 |
| Related human gene: | VPP1 (OMIM:192130) |
| Associated human disease: | distal renal tubular acidosis; osteopetrosis |
| People involved in this project: |
|
| Left primer sequence: | ccattccttttcgctgtcat |
| Right primer sequence: | gcaatctctggtgggaatgt |
| Size of PCR product: | 335 |
| Brief description: | vha-6 (vacuolar H ATPase) is orthologous to the VPP1 gene in humans. The VPP1 gene in humans causes distal renal tubular acidosis and osteopetrosis. |
| Report any problems that might have appeared and any solutions: | |
