Home | Projects | Login or register:
Username:   Password:

Worm gene name:  vha-6
Worm sequence name:  VW02B12L.1
Related human gene:  VPP1 (OMIM:192130)
Associated human disease:  distal renal tubular acidosis; osteopetrosis
People involved in this project: 
Left primer sequence:  ccattccttttcgctgtcat
Right primer sequence:  gcaatctctggtgggaatgt
Size of PCR product:  335
Brief description:  vha-6 (vacuolar H ATPase) is orthologous to the VPP1 gene in humans. The VPP1 gene in humans causes distal renal tubular acidosis and osteopetrosis.
Report any problems that might have appeared and any solutions: 
View(0) or add comments