| Worm gene name: | T13C2.6 |
| Worm sequence name: | T13C2.6 |
| Related human gene: | VLDL receptor (very low density lipoprotein receptor) |
| Associated human disease: | Unertan syndrome |
| People involved in this project: |
|
| Left primer sequence: | cctccaaattttgcgtgttt |
| Right primer sequence: | aaaaccggcacactcatttc |
| Size of PCR product: | 467 |
| Brief description: | Unertan syndrome has been discovered in a family in Turkey. Members of this family walk on all four limbs. The mutation maps to the VLDL receptor. It results in a receptor with no extracellular portion. It causes edema in the brain, which results in brain damage to the region of the brain which directs locomotion. The closest C. elegans ortholog- T13C2.6- has been previously shown to have an embryonic lethal phenotype by RNAi. |
| Report any problems that might have appeared and any solutions: | |
