Home | Projects | Login or register:
Username:   Password:

Worm gene name:  T13C2.6
Worm sequence name:  T13C2.6
Related human gene:  VLDL receptor (very low density lipoprotein receptor)
Associated human disease:  Unertan syndrome
People involved in this project: 
Left primer sequence:  cctccaaattttgcgtgttt
Right primer sequence:  aaaaccggcacactcatttc
Size of PCR product:  467
Brief description:  Unertan syndrome has been discovered in a family in Turkey. Members of this family walk on all four limbs. The mutation maps to the VLDL receptor. It results in a receptor with no extracellular portion. It causes edema in the brain, which results in brain damage to the region of the brain which directs locomotion. The closest C. elegans ortholog- T13C2.6- has been previously shown to have an embryonic lethal phenotype by RNAi.
Report any problems that might have appeared and any solutions: 
View(1) or add comments