Worm gene name: |
T13C2.6
|
Worm sequence name: |
T13C2.6
|
Related human gene: |
VLDL receptor (very low density lipoprotein receptor)
|
Associated human disease: |
Unertan syndrome
|
People involved in this project: |
|
Left primer sequence: |
cctccaaattttgcgtgttt
|
Right primer sequence: |
aaaaccggcacactcatttc
|
Size of PCR product: |
467
|
Brief description: |
Unertan syndrome has been discovered in a family in Turkey. Members of this family walk on all four limbs. The mutation maps to the VLDL receptor. It results in a receptor with no extracellular portion. It causes edema in the brain, which results in brain damage to the region of the brain which directs locomotion. The closest C. elegans ortholog- T13C2.6- has been previously shown to have an embryonic lethal phenotype by RNAi.
|
Report any problems that might have appeared and any solutions: |
|