Home | Projects | Login or register:
Username:   Password:

Worm gene name:  dpy-17
Worm sequence name:  F54D8.1
Related human gene:  NP_00384
Associated human disease:  Ehlers-Danlos Syndrome
People involved in this project: 
Left primer sequence:  tgacggagaagatgctgatg
Right primer sequence:  gtcctggctctccttcctct
Size of PCR product:  449
Brief description:  In humans, Ehlers-Danlos (E.D.) syndrome is a disorder affecting collagen V and produces symptoms in patients including looseness of joints, easily bruisable skin, and rupturing of large blood vessels, bowels, and retinal detachment. Most persons with the Ehlers-Danlos syndrome are born premature because fetal membranes rupture prematurely. Those with E.D. syndrome suffer lacerations from minor trauma. A gene associated with Ehlers-Danlos, type I and II is found on chromosome 2q32 and produces the transcript for alpha-2 type V collagen preprotein (NP_00384). After using this sequence in a BLAST search against the C. elegans genome we retrieved many hits, 20 of which scored 1e-11 or better. We chose two separate C. elegans genes for further study by RNAi. The first, located on chromosome III of C. elegans, is dpy-17, sequence name F54D8.1, WBGene00001076. Dpy-17 encodes a cuticle collagen and is required for normal body shape, hermaphrodite tail development, and outgrowth of posterior canal processes. Previous RNAi experiments targeting dpy-17 have produced the dumpy phenotype and protruding vulva. The second gene chosen was E03G2.3, WBGene00003169, located on chromosome X. This gene encodes mec-5, a member of a Mechanosensory Abnormality gene class. A unique extracellular collagen is produced by mec-5, and is thought to be important for orienting touch receptors and regulating ion channels. In C. elegans, mutations of mec-5 cause worms to be lethargic, and insensitive to touch. Previous large scale RNAi experiments targeting mec-5 have been conducted, although no obvious phenotypes were reported. We have used E-RNAi to design primers that target dpy-17 and mec-5, and await results obtained by upcoming workshop participants.
Report any problems that might have appeared and any solutions: 
View(1) or add comments