| Worm gene name: | tag-144 |
| Worm sequence name: | F36H1.2 |
| Related human gene: | HPC1 |
| Associated human disease: | Prostate Cancer |
| People involved in this project: |
|
| Left primer sequence: | tcatttggcactgagagcac |
| Right primer sequence: | ctgtgcattgcctctttcaa |
| Size of PCR product: | 333 |
| Brief description: | Prostate cancer is a common pathology of human males and is beginning to be understood on the genetic level. The worm ortholog of the human HPC1 gene shows interesting phenotypic changes including exploded vulva. In this phenotype,
the animal is ruptured at the vulva and displays an extrusion of internal organs at the site of rupture. Other vulvar abnormilites are possible, as is a dumpy form. |
| Report any problems that might have appeared and any solutions: | |

