| Worm gene name: | msh-2 |
| Worm sequence name: | H262D21.2 |
| Related human gene: | msh-2 |
| Associated human disease: | Colon Cancer |
| People involved in this project: |
|
| Left primer sequence: | ccagatcgatcacatcaacg |
| Right primer sequence: | tcacagagcacttggaatcg |
| Size of PCR product: | 315 |
| Brief description: | Cololrectal cancer is a major health issue. Several genes have been shown to be associated with hereditary non-polyposis colon cancer, including MSH2. In humans, this gene produces a protein that participates in one of the DNA repair mechanisms. A homolog in c. elegans appears to have a similar function and silencing the msh-2 gene is expected to have an increased frequency of mutation. |
| Report any problems that might have appeared and any solutions: | |
