Home | Projects | Login or register:
Username:   Password:

Worm gene name:  msh-2
Worm sequence name:  H262D21.2
Related human gene:  msh-2
Associated human disease:  Colon Cancer
People involved in this project: 
Left primer sequence:  ccagatcgatcacatcaacg
Right primer sequence:  tcacagagcacttggaatcg
Size of PCR product:  315
Brief description:  Cololrectal cancer is a major health issue. Several genes have been shown to be associated with hereditary non-polyposis colon cancer, including MSH2. In humans, this gene produces a protein that participates in one of the DNA repair mechanisms. A homolog in c. elegans appears to have a similar function and silencing the msh-2 gene is expected to have an increased frequency of mutation.
Report any problems that might have appeared and any solutions: 
View(0) or add comments