Worm gene name: | unc-32 |
Worm sequence name: | zk637.8 |
Related human gene: | ATP6V0A2 |
Associated human disease: | various, reproductive-miscarriages |
People involved in this project: |
|
Left primer sequence: | cagacggtgtgatgaaatgg |
Right primer sequence: | tttcttcagcgtttcctcgt |
Size of PCR product: | 303 |
Brief description: | primers from e-rnai for this vacuolar ATPase gene subunit a2
The protein that it codes for moves from inside the cell to the surface of a subset of natural killer cells in women who have miscarriages. In healthy pregnancy, it is found to be elevated on the surface of B lymphocytes. |
Report any problems that might have appeared and any solutions: | |