| Worm gene name: | unc-32 |
| Worm sequence name: | zk637.8 |
| Related human gene: | ATP6V0A2 |
| Associated human disease: | various, reproductive-miscarriages |
| People involved in this project: |
|
| Left primer sequence: | cagacggtgtgatgaaatgg |
| Right primer sequence: | tttcttcagcgtttcctcgt |
| Size of PCR product: | 303 |
| Brief description: | primers from e-rnai for this vacuolar ATPase gene subunit a2
The protein that it codes for moves from inside the cell to the surface of a subset of natural killer cells in women who have miscarriages. In healthy pregnancy, it is found to be elevated on the surface of B lymphocytes. |
| Report any problems that might have appeared and any solutions: | |
