Home | Projects | Login or register:
Username:   Password:

Worm gene name:  unc-32
Worm sequence name:  zk637.8
Related human gene:  ATP6V0A2
Associated human disease:  various, reproductive-miscarriages
People involved in this project: 
Left primer sequence:  cagacggtgtgatgaaatgg
Right primer sequence:  tttcttcagcgtttcctcgt
Size of PCR product:  303
Brief description:  primers from e-rnai for this vacuolar ATPase gene subunit a2
The protein that it codes for moves from inside the cell to the surface of a subset of natural killer cells in women who have miscarriages. In healthy pregnancy, it is found to be elevated on the surface of B lymphocytes.
Report any problems that might have appeared and any solutions: 
View(1) or add comments