| Worm gene name: | spe-15 |
| Worm sequence name: | F47G6.4 |
| Related human gene: | MYO6 |
| Associated human disease: | deafness |
| People involved in this project: |
|
| Left primer sequence: | gttttggatgtcgctggttt |
| Right primer sequence: | tctcgtctcatagcacaccg |
| Size of PCR product: | 414 |
| Brief description: | The spe-15 gene encodes an unconventional myosin that is homologous to both Drosophila and mouse myosin VI; it also has homologues in many other organisms. spe-15 was identified in C. elegans in screens for defective spermatogenesis. The encoded protein is involved in organelle transport and endocytic trafficking. A missense allele of the human ortholog MYO6 causes a dominant form of sensorineural deafness while other alleles are recessive. |
| Report any problems that might have appeared and any solutions: | |
