Worm gene name:  spe-15
Worm sequence name:  F47G6.4
Related human gene:  MYO6
Associated human disease:  deafness
People involved in this project: 
Left primer sequence:  gttttggatgtcgctggttt
Right primer sequence:  tctcgtctcatagcacaccg
Size of PCR product:  414
Brief description:  The spe-15 gene encodes an unconventional myosin that is homologous to both Drosophila and mouse myosin VI; it also has homologues in many other organisms. spe-15 was identified in C. elegans in screens for defective spermatogenesis. The encoded protein is involved in organelle transport and endocytic trafficking. A missense allele of the human ortholog MYO6 causes a dominant form of sensorineural deafness while other alleles are recessive.
Report any problems that might have appeared and any solutions: 
View(1) or add comments