| Worm gene name: | Lrk-1 |
| Worm sequence name: | T 27C10 |
| Related human gene: | LRRK-2 (PARK 8) |
| Associated human disease: | Parkinson's |
| People involved in this project: |
|
| Left primer sequence: | cccggatcagttaaaacgaa |
| Right primer sequence: | gttggaaggagaagctcgtg |
| Size of PCR product: | 810 |
| Brief description: | LRRK2 is a gene identified in familial forms of Parkinson's disease (PD)and may be central to the pathogenesis of several major neurodegenerative disorders associated with PD. A single LRRK2 mutation (G2019S) causes PD in 5% of individuals with familial disease, although there are other disease segregating mutations known. The LRRK2 gene provides instructions for making a protein segment that is rich in leucine—a feature often used in activities that require protein-protein interactions, such as transmitting signals or helping to assemble the cell's cytoskeleton. It also codes for kinase enzyme activity which suggest the proteins assists phosphorylation--the transfer of a phosphate from ATP to amino acids in certain proteins. There is also evidence for a second enzyme activity referred to as a GTPase activity. In worm, Lrk-1 is a homolog to proteins in Dictyostelium discoidium (slime mold)required for normal phosphorylation and cytoskeltal assemby of myosin during chemotaxis |
| Report any problems that might have appeared and any solutions: | Note that the LRRK-2 mutation is believed to be a toxic gain of function. RNAi in worms (with Lrk-1) has been reported with mixed results. |
