| Worm gene name: | abl-1 |
| Worm sequence name: | m79.1 |
| Related human gene: | abl-1 |
| Associated human disease: | Chronic Myeloid Leukemia |
| People involved in this project: |
|
| Left primer sequence: | ggaactatgccgaaaggaca |
| Right primer sequence: | tttttgctttcaactcgcct |
| Size of PCR product: | 592 |
| Brief description: | ABL-1 inhibits germline apoptosis induced by radiation or by natural aging, but it has no effect on apoptosis induced by starvation or by chemical mutagens (ethylnitrosourea, ethylmethanesulfonate, cisplatin, etoposide), or on constitutive ('physiological') germline apoptosis; at the same time, ABL-1 is required for germline apoptosis induced by oxidative, osmotic or heat-shock stress, |
| Report any problems that might have appeared and any solutions: | M79.1 was transformed into E.coli and then fed to C. elegans to induce an RNAi response. I observed the plate 8 days after transferring rrf-3 wildtype worms to the plate. After 8 days the plate was overgrown with worms and no unusual phenotypes were observed. Future experiments with this gene should have observations begin no later than 3 days after plating worms.
Also, because this gene is a reported regulator of apoptosis in response to radiation or aging, future experiments should include a group that is exposed to radiation. If the gene is deactivated due to RNAi, it is expected that phenotypes would be expressed only under these stress conditions. |
