Home | Projects | Login or register:
Username:   Password:

Worm gene name:  OSM-3
Worm sequence name:  c32f10.2
Related human gene:  KIF17
Associated human disease:  diabetes
People involved in this project: 
  • Ernest Archer, Vista High School, Lynwood Unified School District, CA
Left primer sequence:  cggagctacagaaggacctg
Right primer sequence:  cttgatgatcggctggattt
Size of PCR product:  5
Brief description:  This is all the information I could find at this time.
Report any problems that might have appeared and any solutions:  Gene nameing or identification seems inconsistant. There is a lack of documentation in the web sites. There seems to not be any cross referencing of gene names and function.These sites are not very user friendly.
View(0) or add comments