| Worm gene name: | OSM-3 |
| Worm sequence name: | c32f10.2 |
| Related human gene: | KIF17 |
| Associated human disease: | diabetes |
| People involved in this project: |
|
| Left primer sequence: | cggagctacagaaggacctg |
| Right primer sequence: | cttgatgatcggctggattt |
| Size of PCR product: | 5 |
| Brief description: | This is all the information I could find at this time. |
| Report any problems that might have appeared and any solutions: | Gene nameing or identification seems inconsistant. There is a lack of documentation in the web sites. There seems to not be any cross referencing of gene names and function.These sites are not very user friendly. |
