| Worm gene name: | Collagen WormBase:WBGene00004300 |
| Worm sequence name: | F38A3.2 |
| Related human gene: | NP_536348 |
| Associated human disease: | Crohn's Disease |
| People involved in this project: |
|
| Left primer sequence: | gttgaagggagttcgtggaa |
| Right primer sequence: | tcttgtccggtagatcctgg |
| Size of PCR product: | 426 |
| Brief description: | #266600 INFLAMMATORY BOWEL DISEASE 1; IBD1
REGIONAL ENTERITIS CROHN DISEASE Inflammatory bowel disease is characterized by a chronic relapsing intestinal inflammation. IBD is subdivided into Crohn disease and ulcerative colitis (191390) phenotypes. Crohn disease and ulcerative colitis have a combined prevalence of 200 to 300 per 100,000 in the United States. Crohn disease may involve any part of the gastrointestinal tract, but most frequently the terminal ileum and colon. Bowel inflammation is transmural and discontinuous; it may contain granulomas or be associated with intestinal or perianal fistulas. In contrast, in ulcerative colitis, the inflammation is continuous and limited to rectal and colonic mucosal layers; fistulas and granulomas are not observed. In approximately 10% of cases confined to the rectum and colon, definitive classification of Crohn disease or ulcerative colitis cannot be made and are designated 'indeterminate colitis.' Both diseases include extraintestinal inflammation of the skin, eyes, or joints. Crohn disease and ulcerative colitis are commonly classified as autoimmune diseases. The prevalence of inflammatory bowel disease is increased in individuals with other autoimmune diseases, particularly ankylosing spondylitis, psoriasis, sclerosing cholangitis, and multiple sclerosis. There is strong evidence from twin studies, familial risk data, and segregation analysis that inflammatory bowel disease, especially Crohn disease, is genetic (Yang and Rotter, 1994; Duerr, 1996). Crohn disease and ulcerative colitis are considered complex genetic traits as inheritance does not follow any simple mendelian models. About 10% of persons with regional enteritis have 1 or more close relatives with granulomatous disease of the bowel. In 5 persons of Ashkenazi Jewish origin (ancestors from area of Russia-Poland around Vilna), Sheehan et al. (1967) found red cell glucose-6-phosphate dehydrogenase deficiency associated with regional enteritis or granulomatous colitis. The affected persons were 2 males and 3 females. Regional enteritis and sarcoidosis have been observed in the same family (see 181000); Gronhagen-Riska et al. (1983) commented on the association. Schwartz et al. (1980) found no HLA association in sporadic cases or in familial cases. However, in 5 affected sib pairs, 4 shared both haplotypes (i.e., were HLA-identical) and the 5th shared one haplotype. Only 1 unaffected sib shared both haplotypes with an affected sib. Kuster et al. (1988) suggested that a recessive gene with incomplete penetrance is responsible for susceptibility to Crohn disease. Collagen WormBase:WBGene00004300 ram-2 encodes a cuticle collagen that interacts with unc-6 to affect ray cell migration, and interacts with unc-5 and unc-6 to affect embryonic viability; also affects ray morphology in males such that the structural cells and the hypodermis of the rays are swollen in mutants. |
| Report any problems that might have appeared and any solutions: | Alternate Primers through Primer 3 -
LEFT PRIMER cgagaagaagctttgggttg RIGHT PRIMER ttgagtggtggcttgaacag |
