Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Hex-1
Worm sequence name:  T14F9.3
Related human gene:  NP_000511.2 hexosaminidase A
Associated human disease:  Tay Sachs
People involved in this project: 
Left primer sequence:  attcgccctgattaccactg
Right primer sequence:  cccacacagtttgagcattg
Size of PCR product:  534
Brief description:  Tay-Sachs is caused by the absence of the enzyme hexosaminidase-A (Hex-A). Without Hex-A, a lipid, called GM2 accumulates in cells, especially in the nerve cells of the brain.
Report any problems that might have appeared and any solutions:  .
View(0) or add comments