| Worm gene name: | Hex-1 |
| Worm sequence name: | T14F9.3 |
| Related human gene: | NP_000511.2 hexosaminidase A |
| Associated human disease: | Tay Sachs |
| People involved in this project: |
|
| Left primer sequence: | attcgccctgattaccactg |
| Right primer sequence: | cccacacagtttgagcattg |
| Size of PCR product: | 534 |
| Brief description: | Tay-Sachs is caused by the absence of the enzyme hexosaminidase-A (Hex-A). Without Hex-A, a lipid, called GM2 accumulates in cells, especially in the nerve cells of the brain. |
| Report any problems that might have appeared and any solutions: | . |
