Home | Projects | Login or register:
Username:   Password:

Worm gene name:  N/A
Worm sequence name:  T07H6.5
Related human gene:  ARMD4 (AGE-RELATED MACULAR DEGENERATION); COMPLEMENT FACTOR H
Associated human disease:  macular degeneration
People involved in this project: 
Left primer sequence:  cataccagtccgttgtgacg
Right primer sequence:  tgtgaccatgtggaattgct
Size of PCR product:  544
Brief description:  ARMD4: there is a significant association between ***polymorphism in the gene encoding complement factor H (CFH; 134370) and susceptibility to **age-related macular degeneration.
Complement factor H (CFH), originally known as beta-1H globulin, is a serum glycoprotein that regulates the function of the alternative complement pathway in fluid phase and on cellular surfaces. It binds to C3b (see C3, 120700), accelerates the decay of the alternative pathway convertase C3bBb, and also acts as a cofactor for complement factor I (CFI; 217030), another C3b inhibitor (Ault, 2000; Perez-Caballero et al., 2001).
Report any problems that might have appeared and any solutions: 
View(0) or add comments