| Worm gene name: | gene name N/A K07A12.2 locus = NP_492348 |
| Worm sequence name: | K07A12.2 |
| Related human gene: | P98161.2 |
| Associated human disease: | Polycystic kidney disease |
| People involved in this project: |
|
| Left primer sequence: | tgttcttctggatgtcagcg |
| Right primer sequence: | gattcccgtcaacacgaact |
| Size of PCR product: | 424 |
| Brief description: | In humans:
A number sign (#) is used with this entry because of evidence that polycystic kidney disease (PKD) may arise from mutations in any of several human disease loci; see PKD1 (601313) and PKD2 (173910) for descriptions of genes on chromosomes 16 and 4. See also the PKD3 locus (600666). Adult polycystic kidney disease is an autosomal dominant disorder with the cardinal manifestations of renal cysts, liver cysts, and intracranial aneurysm. Genetic heterogeneity is recognized, with one locus (PKD1), responsible for the most common form, being tightly linked to markers on the extreme distal portion of 16p in the region of the alpha-hemoglobin locus. Using a PKD1 patient with a chromosome translocation, the European Polycystic Kidney Disease Consortium (1994) isolated a novel gene called PBP and detected deletion and splicing mutations associated with independent PKD1 patients (ref: OMIM) In C. elegans: Embryonic lethal-phenotype strain/genotype: NL4256 rrf-3 (pk1426) (ref: WormBase) |
| Report any problems that might have appeared and any solutions: | |
