Home | Projects | Login or register:
Username:   Password:

Worm gene name:  gtl-2
Worm sequence name:  F54D1.5
Related human gene:  15q21
Associated human disease:  Amyotrophic lateral sclerosis-parkinsonism/dementia complex 1,susceptibility
People involved in this project: 
  • Brenda Royal, MLK Science & Engineering Magnet High School, TN
Left primer sequence:  ccgtggggagttatcaagag
Right primer sequence:  ctgcgaacgttctgaaacaa
Size of PCR product:  550
Brief description:  "Amyotrophic lateral sclerosis-parkinsonsim/dementia complex of Guam is a neurodengenerative disorder with unusually high incidence among the Chamorro people of Guam. Both ALS and parkinsonism-dementia are chronic, progressive, and uniformly fatal disorders in this population." With human lifespan continuing to increase with improved medicines, nutrition, etc., the incidence of neurodegenerative disorders increases exponentially with age.
Report any problems that might have appeared and any solutions: 
View(0) or add comments