| Worm gene name: |
gtl-2
|
| Worm sequence name: |
F54D1.5
|
| Related human gene: |
15q21
|
| Associated human disease: |
Amyotrophic lateral sclerosis-parkinsonism/dementia complex 1,susceptibility
|
| People involved in this project: |
- Brenda Royal, MLK Science & Engineering Magnet High School, TN
|
| Left primer sequence: |
ccgtggggagttatcaagag
|
| Right primer sequence: |
ctgcgaacgttctgaaacaa
|
| Size of PCR product: |
550
|
| Brief description: |
"Amyotrophic lateral sclerosis-parkinsonsim/dementia complex of Guam is a neurodengenerative disorder with unusually high incidence among the Chamorro people of Guam. Both ALS and parkinsonism-dementia are chronic, progressive, and uniformly fatal disorders in this population." With human lifespan continuing to increase with improved medicines, nutrition, etc., the incidence of neurodegenerative disorders increases exponentially with age.
|
| Report any problems that might have appeared and any solutions: |
|