| Worm gene name: | unc-26 |
| Worm sequence name: | F56D2.6b |
| Related human gene: | 19q13.1, 7q31.2 |
| Associated human disease: | Cystic Fibrosis |
| People involved in this project: |
|
| Left primer sequence: | tgcatccagtggttctcaag |
| Right primer sequence: | attgaaccaaccaccaaagc |
| Size of PCR product: | 436 |
| Brief description: | This is a gene involved in transporting chloride ions across cell membranes.Cystic fibrosis transmembrane conductance regulator (CFTR) functions as a chloride channel and controls the regulation of other transport pathways. Mutations in the CFTR gene cause the disease cystic fibrosis, which is inherited as an autosomal recessive disease and is more common among Americans whose ancestors are from European nations. Those persons affected may develop frequent lung infections as well as a decrease in pancreatic enzymes resulting in poor growth and vitamin deficiency. Life expectancy among Americans with CF is now in the 40s and low 50s. |
| Report any problems that might have appeared and any solutions: | |
