| Worm gene name: | ets-5- (ETS class transcription factor) |
| Worm sequence name: | C42D8.4 |
| Related human gene: | ets variant gene 1 |
| Associated human disease: | Prostate Cancer |
| People involved in this project: |
|
| Left primer sequence: | gagcggaagaggtgagaatg |
| Right primer sequence: | ttgccacctttttggaagtc |
| Size of PCR product: | 594 |
| Brief description: | In humans, the mutation in the ets variant gene 1 causes the emergence of the disease Prostate Cancer that occurs in males with prevalent occurrence in elderly males. Prostate cancer causes the inflammation of the prostate gland causing symptoms such as difficulty in passing urine and pain in the lower abdomen. A homologuous gene in C. elegans, ets-5-(ETS class transcription factor) with sequence name C42D8.4. |
| Report any problems that might have appeared and any solutions: | The forward and reverse primer sequences that amplifies the related worm gene sequence, C42D8.4 were obtained from E-RNAi and Sigma Aldrich. Worm lysate of C.elegans was spinned down and PCR was conducted together with the primers. The amplified DNA was then subjected to Gel Electrophoresis and results showed that the chosen gene sequence of C42D8.4 was amplified. These forward and reverse primers can be further used to study the orthologous worm gene sequence to the ets variant gene 1 that causes prostate cancer in human males. |
