Home | Projects | Login or register:
Username:   Password:

Worm gene name:  ptl-1
Worm sequence name:  F42G9.9b.1
Related human gene:  microtubule-associated protein tau isoform 5 (MAPT)
Associated human disease:  Dementia
People involved in this project: 
Left primer sequence:  cagagcccgaaccagtagtc
Right primer sequence:  gcgttgagacgagggagtag
Size of PCR product:  505
Brief description:  Wszolek et al. (1992) reported a large kindred in which 32 members in 8 generations had a neurodegenerative disorder characterized by progressive parkinsonism with dystonia, dementia, ocular motility abnormalities, pyramidal tract dysfunction, frontal lobe release signs, perseverative vocalizations, and urinary incontinence. The course was exceptionally 'aggressive'; onset of symptoms and death consistently occurred in the fifth decade.
Report any problems that might have appeared and any solutions: 
View(0) or add comments