| Worm gene name: | ptl-1 |
| Worm sequence name: | F42G9.9b.1 |
| Related human gene: | microtubule-associated protein tau isoform 5 (MAPT) |
| Associated human disease: | Dementia |
| People involved in this project: |
|
| Left primer sequence: | cagagcccgaaccagtagtc |
| Right primer sequence: | gcgttgagacgagggagtag |
| Size of PCR product: | 505 |
| Brief description: | Wszolek et al. (1992) reported a large kindred in which 32 members in 8 generations had a neurodegenerative disorder characterized by progressive parkinsonism with dystonia, dementia, ocular motility abnormalities, pyramidal tract dysfunction, frontal lobe release signs, perseverative vocalizations, and urinary incontinence. The course was exceptionally 'aggressive'; onset of symptoms and death consistently occurred in the fifth decade. |
| Report any problems that might have appeared and any solutions: | |
