| Worm gene name: | C18H7 |
| Worm sequence name: | C18H7 |
| Related human gene: | |
| Associated human disease: | von Willebrand factor |
| People involved in this project: |
|
| Left primer sequence: | aaaactgccgaattttggtg |
| Right primer sequence: | gagccccgaatagacaatca |
| Size of PCR product: | 547 |
| Brief description: | von Willebrand factor and related coagulation proteins. A hemorrhagic condition in persons living on the Aland Islands in the Sea of Bothnia between Sweden and Finland and called it 'pseudohemophilia.' |
| Report any problems that might have appeared and any solutions: | |
