Home | Projects | Login or register:
Username:   Password:

Worm gene name:  C18H7
Worm sequence name:  C18H7
Related human gene: 
Associated human disease:  von Willebrand factor
People involved in this project: 
Left primer sequence:  aaaactgccgaattttggtg
Right primer sequence:  gagccccgaatagacaatca
Size of PCR product:  547
Brief description:  von Willebrand factor and related coagulation proteins. A hemorrhagic condition in persons living on the Aland Islands in the Sea of Bothnia between Sweden and Finland and called it 'pseudohemophilia.'
Report any problems that might have appeared and any solutions: 
View(0) or add comments