| Worm gene name: | lin-35 (abnormal cell LINeage family member) |
| Worm sequence name: | C32F10.2 |
| Related human gene: | Retinoblastoma 1 |
| Associated human disease: | Retinoblastoma |
| People involved in this project: |
|
| Left primer sequence: | caaccgtttcctgtttcgat |
| Right primer sequence: | ccaccaaattgtgtgcaaag |
| Size of PCR product: | 476 |
| Brief description: | This genetic disease affects the eyesight of young children particularly below the age of 5. Cancerous cells originating from the eyes spread fast to other parts of the body.
lin-35 encodes the C. elegans retinoblastoma protein (Rb) ortholog; lin-35 was first identified in screens for synthetic multivulva (synMuv) genes and as a class B synMuv gene, functions redundantly with class A genes to antagonize Ras signaling and negatively regulate vulval development; in addition, lin-35 activity is required redundantly with: 1) pha-1 and ubc-18 for early steps in pharyngeal morphogenesis, 2) fzr-1 for normal patterns of postembryonic proliferation, 3) xnp-1 for somatic gonad development, and 4) psa-1 for fertility and embryonic and larval development; on its own, lin-35 is also required for wild-type levels of fertility; LIN-35 is expressed broadly in embryos and L1 larvae, but in later larvae and adults is detected in vulval precursor cells and their descendants as well as a subset of head and tail cells. I designed primers for the RNAi silencing probe using eRNAi. I performed PCR to evaluate the effectiveness of the primers. A specific positive correct sized band was amplified successfully. |
| Report any problems that might have appeared and any solutions: | |
