| Worm gene name: | pat-2 |
| Worm sequence name: | F54F2.1 |
| Related human gene: | Platelet Glycoprotein IIb |
| Associated human disease: | Glanzman's thrombasthenia |
| People involved in this project: |
|
| Left primer sequence: | gctccagcttgttctccaac |
| Right primer sequence: | ggaaaatgatggccagaaga |
| Size of PCR product: | 435 |
| Brief description: | Glanzman's thrombasthenia is characterized by increased clotting time due to a mutation in the GPIIb gene. Glycoprotein IIb and Glycoprotein IIa (GPIIIa) are associated in the membrane of the platelet. The platelet is activated by such endogenous agonists as ADP and thrombin. The GPIIb/IIIa complex assumes a different conformation at this point abd accomodates the binding of fibrinogen (Fg). Fibrinogen is a dimeric protein that cross-links neighboring platelets by binding to their GPIIb/IIIa complexes. The aggregation of platelets due to this cross-linking is important in stemming the flow of blood from a wound. Patients with Glanzman's have varying abilities to stop blood flow due to defective binding of Fg to GPIIb/IIIa. |
| Report any problems that might have appeared and any solutions: | |
