| Worm gene name: | sir-2.1 |
| Worm sequence name: | R11A8.4 or WB gene ID WBGene00004800 |
| Related human gene: | SIRT1 |
| Associated human disease: | longevity? |
| People involved in this project: |
|
| Left primer sequence: | cggggaagtgcaagaaataa |
| Right primer sequence: | tcctcacgaatctcattccc |
| Size of PCR product: | 789 |
| Brief description: | In the news recently is hype about red wine as the new fountain of youth because of a human homolog of the worm and yeast protein product of this gene, sir-2.1, that is induced by resveratrol, a component of some red wines. The abstract from a paper, A Role for SIR-2.1 Regulation of ER Stress in the following paper,Response Genes in Determining . Life Span . Developmental Cell , Volume 9 , Issue 5 , Pages 605 - 615M . Viswanathan , S . Kim , A . Berdichevsky , L . Guarente explains further. The authors say, "C. elegans SIR-2.1, a member of the Sir-2 family of NAD+-dependent protein deacetylases, has been shown to regulate nematode aging via the insulin/IGF pathway transcription factor daf-16. Treatment of C. elegans with the small molecule resveratrol, however, extends life span in a manner fully dependent upon sir-2.1, but independent of daf-16. Microarray analysis of worms treated with resveratrol demonstrates the transcriptional induction of a family of genes encoding prion-like glutamine/asparagine-rich proteins involved in endoplasmic reticulum (ER) stress response to unfolded proteins. RNA interference of abu-11, a member of this ER stress gene family, abolishes resveratrol-mediated life span extension, and overexpression of abu-11 extends the life span of transgenic animals. Furthermore, SIR-2.1 normally represses transcription of abu-11 and other ER stress gene family members, indicating that resveratrol extends life span by inhibiting sir-2.1-mediated repression of ER stress genes. Our findings demonstrate that abu-11 and other members of its ER stress gene family are positive determinants of C. elegans life span." |
| Report any problems that might have appeared and any solutions: | |
