| Worm gene name: | T07D3.4 |
| Worm sequence name: | T07D3.4 |
| Related human gene: | fukutin |
| Associated human disease: | muscular dystrophy |
| People involved in this project: |
|
| Left primer sequence: | ggatttatcggtctttgcga |
| Right primer sequence: | gctctgtgtacagcacggaa |
| Size of PCR product: | 735 |
| Brief description: | right primer start at 1608 left primer start 2342 |
| Report any problems that might have appeared and any solutions: | |
