Home | Projects | Login or register:
Username:   Password:

Worm gene name:  T07D3.4
Worm sequence name:  T07D3.4
Related human gene:  fukutin
Associated human disease:  muscular dystrophy
People involved in this project: 
Left primer sequence:  ggatttatcggtctttgcga
Right primer sequence:  gctctgtgtacagcacggaa
Size of PCR product:  735
Brief description:  right primer start at 1608 left primer start 2342
Report any problems that might have appeared and any solutions: 
View(0) or add comments