Home | Projects | Login or register:
Username:   Password:

Worm gene name:  F07h5.2
Worm sequence name:  184162
Related human gene:  SGCG sarcoglycan, gamma (35kDa dystrophin-associated glycoprotei
Associated human disease:  muscular dystrophy
People involved in this project: 
Left primer sequence:  accacttgttccttgccaac
Right primer sequence:  ttccttcaacccgaatacca
Size of PCR product:  552
Brief description:  right primer start at 2 left primer start at 553
Report any problems that might have appeared and any solutions: 
View(0) or add comments