| Worm gene name: | F07h5.2 |
| Worm sequence name: | 184162 |
| Related human gene: | SGCG sarcoglycan, gamma (35kDa dystrophin-associated glycoprotei |
| Associated human disease: | muscular dystrophy |
| People involved in this project: |
|
| Left primer sequence: | accacttgttccttgccaac |
| Right primer sequence: | ttccttcaacccgaatacca |
| Size of PCR product: | 552 |
| Brief description: | right primer start at 2 left primer start at 553 |
| Report any problems that might have appeared and any solutions: | |
