| Worm gene name: | APL-1 |
| Worm sequence name: | C42D8.8 |
| Related human gene: | APP (amyloid beta A4 precursor protein) |
| Associated human disease: | familial Alzheimers Disease |
| People involved in this project: |
|
| Left primer sequence: | gtgatgaaggagtggggaga |
| Right primer sequence: | aagccgatgaataacggttg |
| Size of PCR product: | 458 |
| Brief description: | Twisted plaques are visible in the brains of people with Alzheimer's disease. This human gene produces the precursor protein that is found in the plaques. The human precursor protein is long (alternate splicing produces many forms included forms of 695 and 770 amino acids), but the processed protein found on human brains is 39-42 amino acids. The C. elegans homologous protein is 686 amino acids. The C. elegans gene has 12 exons. In C. elegans, this gene is involved in molting, morphogeneses, and pharyngeal pumping. |
| Report any problems that might have appeared and any solutions: | No known problems at this time. |
