Worm gene name: | fasn-1 |
Worm sequence name: | F32H2.5 |
Related human gene: | p63 |
Associated human disease: | tumor suppression |
People involved in this project: |
|
Left primer sequence: | acgtacttgatcaccggagg |
Right primer sequence: | aagagttccaccaacaacgg |
Size of PCR product: | 866 |
Brief description: | This gene encodes a fatty acid synthase like human FASN (Omim:600212) and the protein might be a direct target of p53-like proteins. |
Report any problems that might have appeared and any solutions: | |