Worm gene name:  fasn-1
Worm sequence name:  F32H2.5
Related human gene:  p63
Associated human disease:  tumor suppression
People involved in this project: 
Left primer sequence:  acgtacttgatcaccggagg
Right primer sequence:  aagagttccaccaacaacgg
Size of PCR product:  866
Brief description:  This gene encodes a fatty acid synthase like human FASN (Omim:600212) and the protein might be a direct target of p53-like proteins.
Report any problems that might have appeared and any solutions: 
View(0) or add comments