| Worm gene name: | fasn-1 |
| Worm sequence name: | F32H2.5 |
| Related human gene: | p63 |
| Associated human disease: | tumor suppression |
| People involved in this project: |
|
| Left primer sequence: | acgtacttgatcaccggagg |
| Right primer sequence: | aagagttccaccaacaacgg |
| Size of PCR product: | 866 |
| Brief description: | This gene encodes a fatty acid synthase like human FASN (Omim:600212) and the protein might be a direct target of p53-like proteins. |
| Report any problems that might have appeared and any solutions: | |
