| Worm gene name: | cep-1 |
| Worm sequence name: | F52B5.5a |
| Related human gene: | TRP 53 |
| Associated human disease: | tumor |
| People involved in this project: |
|
| Left primer sequence: | gtcttcatggatgcgttcct |
| Right primer sequence: | ccgtttgcattgaacaacac |
| Size of PCR product: | 393 |
| Brief description: | Right primer starts at 4044 and left primer starts at 4436. |
| Report any problems that might have appeared and any solutions: | |
