Worm gene name: | DJ-1 |
Worm sequence name: | B04322.2 |
Related human gene: | PARK7 |
Associated human disease: | Parkinson's disease |
People involved in this project: |
|
Left primer sequence: | agctgaggaaatggaggtca |
Right primer sequence: | gcggacaagtaggctttcag |
Size of PCR product: | 419 |
Brief description: | Parkinson's disease is a movement disorder characterized by loss of dopaminergic neurons.
DJ-1 interacts with p53 in vivo and in vitro; it inhibits the p53-Bax-caspase pathway (and thus affects apoptosis). |
Report any problems that might have appeared and any solutions: | |