Worm gene name:  DJ-1
Worm sequence name:  B04322.2
Related human gene:  PARK7
Associated human disease:  Parkinson's disease
People involved in this project: 
Left primer sequence:  agctgaggaaatggaggtca
Right primer sequence:  gcggacaagtaggctttcag
Size of PCR product:  419
Brief description:  Parkinson's disease is a movement disorder characterized by loss of dopaminergic neurons.
DJ-1 interacts with p53 in vivo and in vitro; it inhibits the p53-Bax-caspase pathway (and thus affects apoptosis).
Report any problems that might have appeared and any solutions: 
View(0) or add comments