| Worm gene name: | DJ-1 |
| Worm sequence name: | B04322.2 |
| Related human gene: | PARK7 |
| Associated human disease: | Parkinson's disease |
| People involved in this project: |
|
| Left primer sequence: | agctgaggaaatggaggtca |
| Right primer sequence: | gcggacaagtaggctttcag |
| Size of PCR product: | 419 |
| Brief description: | Parkinson's disease is a movement disorder characterized by loss of dopaminergic neurons.
DJ-1 interacts with p53 in vivo and in vitro; it inhibits the p53-Bax-caspase pathway (and thus affects apoptosis). |
| Report any problems that might have appeared and any solutions: | |
